Review



firepol polymerase i  (Solis BioDyne)


Bioz Verified Symbol Solis BioDyne is a verified supplier
Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Solis BioDyne firepol polymerase i
    Firepol Polymerase I, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 445 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/firepol+polymerase+i/FIREPol+DNA+Polymerase/pmc08835740-108-26-29
    Average 96 stars, based on 445 article reviews
    firepol polymerase i - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Cloning:

    Article Title: Construction and validation of an RNA trans -splicing molecule suitable to repair a large number of COL7A1 mutations
    Article Snippet: Chemical transformation of the ligation was performed into DH5α chemically competent cells (Invitrogen, Waltham, MA, USA) according to the manufacturer's protocol. .. After cloning, the presence of RTMs with distinct BDs was analysed by colony PCR using Firepol polymerase I (Solis Biodyne, Tartu, Estonia) and vector-specific primers (forward: 5′-TAATACGACTCACTATAGGG-3′ reverse: 5′-CATTGTGGGCGTTGTAG-3′). ..

    Polymerase Chain Reaction:

    Article Title: Construction and validation of an RNA trans -splicing molecule suitable to repair a large number of COL7A1 mutations
    Article Snippet: Chemical transformation of the ligation was performed into DH5α chemically competent cells (Invitrogen, Waltham, MA, USA) according to the manufacturer's protocol. .. After cloning, the presence of RTMs with distinct BDs was analysed by colony PCR using Firepol polymerase I (Solis Biodyne, Tartu, Estonia) and vector-specific primers (forward: 5′-TAATACGACTCACTATAGGG-3′ reverse: 5′-CATTGTGGGCGTTGTAG-3′). ..

    Article Title: 5′RNA Trans -Splicing Repair of COL7A1 Mutant Transcripts in Epidermolysis Bullosa
    Article Snippet: Downstream of the spacer region, randomly generated BDs, created by sonication or restriction digest of a purified (GFX gel purification, GE Healthcare, Buckinghamshire, UK) COL7A1 exon / intron 64 PCR product, were cloned into the EcoRV restriction site. .. Upon transformation into TOP10 chemically competent cells (Invitrogen, Carlsbad, CA, USA), bacterial clones carrying an RTM with a distinct BD were identified by colony PCR using Firepol polymerase I (Solis Biodyne, Tartu, Estonia) and vector-specific primers (fw: 5′gctgaccctgaagttcatctg 3′, rv: 5′caccccaccccccagaatag 3′). ..

    Transformation Assay:

    Article Title: 5′RNA Trans -Splicing Repair of COL7A1 Mutant Transcripts in Epidermolysis Bullosa
    Article Snippet: Downstream of the spacer region, randomly generated BDs, created by sonication or restriction digest of a purified (GFX gel purification, GE Healthcare, Buckinghamshire, UK) COL7A1 exon / intron 64 PCR product, were cloned into the EcoRV restriction site. .. Upon transformation into TOP10 chemically competent cells (Invitrogen, Carlsbad, CA, USA), bacterial clones carrying an RTM with a distinct BD were identified by colony PCR using Firepol polymerase I (Solis Biodyne, Tartu, Estonia) and vector-specific primers (fw: 5′gctgaccctgaagttcatctg 3′, rv: 5′caccccaccccccagaatag 3′). ..

    Clone Assay:

    Article Title: 5′RNA Trans -Splicing Repair of COL7A1 Mutant Transcripts in Epidermolysis Bullosa
    Article Snippet: Downstream of the spacer region, randomly generated BDs, created by sonication or restriction digest of a purified (GFX gel purification, GE Healthcare, Buckinghamshire, UK) COL7A1 exon / intron 64 PCR product, were cloned into the EcoRV restriction site. .. Upon transformation into TOP10 chemically competent cells (Invitrogen, Carlsbad, CA, USA), bacterial clones carrying an RTM with a distinct BD were identified by colony PCR using Firepol polymerase I (Solis Biodyne, Tartu, Estonia) and vector-specific primers (fw: 5′gctgaccctgaagttcatctg 3′, rv: 5′caccccaccccccagaatag 3′). ..



    Similar Products

    96
    Solis BioDyne firepol polymerase i
    Firepol Polymerase I, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/firepol+polymerase+i/FIREPol+DNA+Polymerase/pmc08835740-108-26-29
    Average 96 stars, based on 1 article reviews
    firepol polymerase i - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Solis BioDyne i e firepol dna polymerase
    I E Firepol Dna Polymerase, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/firepol+polymerase+i/FIREPol+DNA+Polymerase/pmc05975666-281-14-19
    Average 96 stars, based on 1 article reviews
    i e firepol dna polymerase - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Solis BioDyne firepol dna polymerase i
    Firepol Dna Polymerase I, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/firepol+polymerase+i/FIREPol+DNA+Polymerase/pmc05226114-186-16-20
    Average 96 stars, based on 1 article reviews
    firepol dna polymerase i - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Solis BioDyne hot firepol dna polymerase i
    Hot Firepol Dna Polymerase I, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/firepol+polymerase+i/HOT+FIREPol+DNA+Polymerase/10__1128_slash_jb__01537___09-82-50-55
    Average 96 stars, based on 1 article reviews
    hot firepol dna polymerase i - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results